Gene Analysis Essay Example | Topics and Well Written Essays - 1000 words

Gene Analysis - Essay ExampleGene therapy, combine vectors carrying therapeutic trans component sequences offers the potential for a permanent cure of componenttic diseases by stable vector origination into the patients chromosomes (1). However there are some reports indicating occurrence of tumors at later stage in transgenic living creature and thats why it is important to know probability of non specific integration of this transgene and its effect on mobile phoneular homeostasis. As per the present understanding the integration is semi-random in nature and having partial preference towards sequences in or skillful the coding regions of expressed genes (1). Integration in these places may lead to up or down command of that particular gene and hence increase the probability of interference in cellular homeostasis. Based on above observations, it is highly recommended to verify the insertion loci of given vectors in model system. Based on bio-informatical analytic thinking o f given sequence, we were able to demonstrated that Viral vector integrates in vicinity to gene called Nfib (Nuclear factor I/B) and interferes with it normal functioning. Detailed investigation and database search indicates Nfib has potential role in cell cycle canon and oncogenesis.Vectors, transfection, cloning, amplification and sequencing were performed as per previously mention protocol (1). For identification of gene and its functionality sequence was husk against the walk genome database (http//www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgitaxid=10090). Similarly for further verification, sequence was BLAT (http//genome.brc.mcw.edu/cgi-bin/hgBlat) and also compared in RTCGD (http//rtcgd.abcc.ncifcrf.gov/). , to investigate presence of similar gene entry in the data base.GeneSequence 5AAAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAATAATAAA AGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 3Results and discussion The sequence was used for similarity search by BLAST i n mouse genome database. All the default parameters were kept without changing for identification of match. Fig 1 shows results obtained later BLAST of given sequence.FIG 1 BLAST resultsrefNT_039260.7Mm4_39300_37 Mus musculus chromosome 4 genomic contig, strain C57BL/6Jduration=28591323 Features in this part of subject sequence nuclear factor I/B Score = 191 bits (103), wear = 1e-46 Identities = 103/103 (100%), Gaps = 0/103 (0%) Strand=Plus/PlusQuery 2 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 61 Sbjct 21590158 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 21590217Query 62 AATAAAAGACAGCCAGTTGAAGGAAGAtttttttttttCAATT 104Sbjct 21590218 AATAAAAGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 21590260 As seen above, 100% matching were obtained with very low E values (1e-46) which clearly indicates the given sequence belongs to gene called nfib (Nuclear factor I/B). It is located on chromosome 4 (Chr481761404-82176981 bp, - strand). Nfib is member of protein famil y having diverged role in transcription and cell cycle regulation.Similarly BLAT analysis retrieves same gene against the query of given sequence.

Career paper Essay Example | Topics and Well Written Essays - 500 words

Career paper - Essay Exampleic installations, preparing the software and scrutiny it for the processing of documents, distribution of software, planning and scheduling of the project milestones for sequencely delivery of the project, software troubleshooting, determination of the time for management escalation, being up-to-date on the latest enhancements made to the software. The Systems Consultant may be requisite to provide support on call in the off hours. They similarly carry out on-the-spot(prenominal) field testing as well as analysis of results at the facilities of the client.Growth opportunities for an individual with a degree in Information Systems are plentiful in the present age. From the year 2010 to the year 2020, the project growth in employment by 18 per cent is faster than average whereas the average profits of an Information Systems Technologist ranges up to $52,000 that is also above average (Diploma Guide, 2013).Skills required of a Systems Consultant compli cate experience with integrated 3rd party applications, hardware, and operating systems. Experience in providing technical implementations may also be very useful for the entry-level

Managerial Position of Manager Bank of America Essay

passenger carial Position of Manager rely of America - Essay ExampleA honorable fuckr can direct to more productive outcomes and is able to increase the achievements of whatever organization. Good attention can improve the reputation of the marge and job satisfaction of employees. Thus, it can provide good customer satisfaction and increase the customer base. Managerial Functions Bank manager is in charge for the overall procession and performance of the coast and the employees. The function of bank manager is to ensure superior service quality, business advancement and accomplishment of target (Peke, n.d.). The most important function of a bank manager in Bank of America is to develop the business of the bank. Bank manager always strives to increase the income through increasing the customer base. Bank manager is liable for setting the goals and planning a way to fulfill them. It is the function of bank manager to regularly examine the progression of other competitor ban ks and assess their business activities. A bank manager must ensure to maintain the professional standard and the policy of the bank (Stanley St Labs, n.d.). Kinds of Managers Control monster This type of managers like to control all operations of the bank on his own. They do not prefer employees to make any liberal of managerial decision whether it is a small decision or big. This patient of of manager never tells the details about any assignment to complete it. Autocratic Manager of this kind does not care about the workers. This type of manager is quite tuff and they are pretty illume about their need. Team Builder This kind of managers is proficient at their work. They are quite open penny-pinching subordinates and they seek for creativity from the workers. These kinds of managers do any task in particular way and by involving the employees. Managerial Roles In banking there are several roles for managers which are Operation manager These types of managers are open to the customers and afford good communication adroitness. They deal with the customer directly about any kind of problem. Retail manager These types of managers handles the retail operations such as bank cashier, ATM operations, manage the deposit and withdrawal, money order, utility-grade bill and others. Investment manager The role of investment manager is to manage the account of customer, freight brokerage, give way the investment, and manage the investment fund and operational investments. Financial manager The role of financial manager is to manage the bill, account, and other financial services. Loan manager Loan manager assess the loan requests, verify the customers potential to repay the loan amount and provide approval of loan. These types of managers are specialized in business, consumer and credit contribute (Profitableinvestment, 2011). Managerial Skills Technical A manager must be able to use specific methods or techniques to perform the managerial task. The technical skill is not associated with usage of equipment, machinery or technology. It is related with the usage of several(a) managerial techniques in decision making such as break even analysis, planning any training program, conduct an interview and others. Interpersonal A manager must possess skill to get hold of the employees. The interpersonal skills of manager consist of motivating the employees, resolving any disagreement and communicating with customers and other people. conceptual Conceptual skills are extremely important for middle level or top level managers. A manager should be capable of grasping the whole picture of any bank. Communication This is the basic skill of all bank managers. A manag

D2 Assignment Example | Topics and Well Written Essays - 500 words - 1

D2 - Assignment ExampleThe surroundings is critical in shaping and determining the youngsters development. In transition to parenthood, Cochenour and Chrisman (61) explain this acquaint to be a critical stage where the young parents are redefining their career growth, while at the alike time a nestling comes along to require more economic aid and care from the two. Thus check to Cochenour and Chrisman, a child can be source of joy or conflict the care of the child puts more strain on the parents, who are still required to utilize their strengths in defining their saucily career goals (Cochenour and Chrisman 64). The extended family thus chips in to offer the child the required development the child no long belongs to the parents alone, but has to identify her/ himself with the large family context as all the family members have a business office to play in shaping the childs development. In addition, this brings about the sense of belonging and inclusiveness, which is requi site in defining identity. To solve the problems of conflict between parents as the new child requires more attention and care from the two both parents have to actively participate in rearing the child the intention should never be left as an obligation of a particular parent. This creates the required environment for child development. Parents should also choose an environment that would be constructive in the childs development.In arrangement the structure of a family, the family systems supposition would be of much importance to childhood educators. Cochenour and Chrisman (62) explain that the theorys primary concept is that the family consists of interconnected members, with each member influencing the other in predictable and recurring ways. The theory would largely focus on the family behaviors and history to influence an individuals behavior. Therefore, understanding this theory would servicing early child educators to have prior knowledge related to the several types of families,

Value chain for carrefour company Essay Example | Topics and Well Written Essays - 250 words

Value chain for carrefour company - Essay ExampleThis ensures that the company meets the needs and requirements of its legion(predicate) clients. In order to secure node loyalty and competitive advantage, crossroad offers its customers with a full plectrum of products at best prices.Carrefour trading operations focus on providing products that meet the needs of a wide diverge of customer requirements. The retailer has every store format that meets the needs of its customers and copes with changing market trends. Carrefour has hypermarkets, supermarkets, convenience stores, cash and carry stores (Carrefour, 2012). The company uses current technologies and innovations to strengthen its operations.Carrefour seeks to offer the best range of products and services to its customers. The companys convenience stores offer convenient services and practicality to its customers. Carrefours operations seek to meet the requirements of its customers.Carrefour uses Electronic Data Interchange system for procurement of its products. The company makes these products accessible to customers through a variety of stores worldwide. Carrefour human resource management ensures that every(prenominal) personnel stick out quality services to customers all over the world. This is by strengthening human resource department and customer relations.Carrefour combined with See Beyond to implement and install integrated composite application meshwork software. This was to enhance its operations and deliver quality services and goods to its customers. The software would allow Carrefour to customize its operations to various local conditions. Using the software, Carrefour would integrate its stores, distribution centers and local supply chain partners all over the world.Carrefour strengthened its inbound logistics by giving its managers the freedom to buy products from local suppliers. This increases customer loyalty thus, offering the company competitive regional advantage in differen t areas (Carrefour,

Persecution of Women in the Middle East Essay Example | Topics and Well Written Essays - 1000 words

Persecution of Wo workforce in the spirit due east - Essay ExampleMany Christian women live in restricted countries where Christianity is not tolerated--over two hundred million Christians in 80 countries worldwide are persecuted because of their belief. Women of the Way is a program of Open Doors mobilizing women to fuck off strategically involved in strengthening persecuted Christians and works to educate and minister to these women, whose social situations often prohibit them from receiving Christian materials or speaking out freely about their faith. (Persecuted Women) Women are still considered the weaker sex in the nerve East and they are oppressed day in, day out. Women are primarily oppressed because of their faith in Christianity. Many Christian women have had to bear the brunt of this and many continue to face the consequences of their religious beliefs. It is unfeignedly sad that these women cant be helped it is high time to put these women out of their misery. The y sink into despair when they are ostracized or persecuted. Some of them are even killed because of their faith in Christianity, this is unacceptable and something has to be done about this rather rather than later.Islam is misunderstood by the Muslims and they tend to punish the women, they end up banishing these poor women. They inflict anguish upon them and they fail to realize the real values of Islam. Religious belief is the most important reason because of which the women in the Middle East are persecuted. ... This has been a very popular practice in the Middle East women must be protected at all costs and they must be given overmuch better treatment than what they are receiving. Under the Islamic Republic of Iran, discrimination and segmentation on the fanny of religion and gender have been institutionalized in the constitution, government policies, and state ideology. The system explicitly favors men over women, Muslims over non-Muslims, and Shiite Muslims over other Mus lim sects.The constitution and the Sharia-based penal and civil codes, especially those sections pertaining to family and ad hominem status, legalize the subordination of women, treating them as second-class citizens with unequal rights. Womens rights activists have launched widely publicized equal-rights campaigns that have been sure-fire within the parameters established by the theocracy. However, the overall legal framework remains discriminatory, with the states theocratic underpinnings consistently negating its progressive and democratic elements. (Access to Justice)Islam restricts women from wearing revealing fit out and any woman found wearing revealing clothes is often persecuted. These draconian laws are only for women, no such laws exist for men in the Middle East. Women are targeted in the name of Islam Islam never supports persecution of women. Human beings have started deriving satisfaction by inflicting painfulness upon other human beings. This practice of persecu tion goes to reflect the pain inflicting tendencies in place women get exploited in the name of Islam. They cant go out nor can they attend a school. They remain uneducated and weak, this is a regularity of exploiting them and this is also a

Hospitality Industry Management Essay Example | Topics and Well Written Essays - 500 words

Hospitality Industry Management - Essay ExampleIn their analysis, (Elliot et al 2012, 94) agree that Ku-De-Ta Hotels should assess the consequences of total customers in relation to other substitute products offered by pair hotels. It means they should introduce incentives for retaining loyalty program. This will limit the buyer alternatives enjoyed by most customers.Another crucial implication involves expansions of economies of scale because of rigid government policy. Australia has complicated legislations of conducting business that often affect constancy profitability. Consequently, (Gordon, 2012, 125) believes Ku-De-Ta Hotel deserve to invest in product differentiation to establish a strong brand and customer loyalty.In brand loyalty, threats should be averted by accessing equal distribution of products and services in the new market. It should also invest in modern modes of advertising such as the use of Facebook, Twitter, or blogs to establishing lasting rapport with bou rgeois clients frequently using technology (Knight, 2013, 114).However, this is only possible by having adequate capital requirements to sustain industry profitability that usually balances the absolute constitutes of conducting business. Accordingly, (Morrison 2002, 123) assert that capital requirements could be solicited through loans or savings.The launching of new entrants will lead to low threats because of setbacks such as expected competition and low cost benefits. Ku-De-Ta Hotel also has an edge over others because of its feasible location proves it difficult for new entrants (Knight, 2013, 124).In switching costs, Ku-De-Ta Hotel is confront with the threat of their rivals who offer substitute products and, thus, interfere with customer loyalty. This suggests that customers are susceptible to alternatives such as identifying hotels that take away warm water instead of cold water. It, thus, is upon Ku-De-Ta Hotel