Friday, May 31, 2019
Essay --
Based upon the opinion of these important aspects, therapist psycho-educate the family and adolescent ab discover the important findings of the detailed interview and plan out the intervention.Case example of assessment findings in obese adolescent little girlThe mother of a 12-year-old girl came for consultation for her daughters weight concerns and comments that the girl is concerned about her weight and is being teased about this at school and in the family. There is a family history of obesity in parents and grandparents. During the assessment it was found that the girls main interests are sedentary activities like watching T.V., internet use and playing video games. Physical activity is limited, filmdom time is 4-5 hours a day and dietary habits put her at risk of weight gain (skipping breakfast, frequent snacking, consuming soft drinks, and high preference of tear apart food). The girl has not attained menarche and has a BMI above the 95th percentile on the US-CDC growth ch art and normal lipid profile, liver function test, glucose and insulin levels. On psychosocial assessment, she was found to be anxious and depressed due to her increasing weight, body image concerns and previous failed attempts of weight loss. She lost her confidence and has low self esteem. She indulged in emotional eating as well to overcome her stress. She has fewer friends as most of the people tease her about her weight. So she prefers to stay alone feeling Obese with high risk of further weight gain and psycho-social problems. Components & Structure of Cognitive Behaviour therapyThere is enough evidence to support the effectiveness of encyclopedic behavioural intervention program that include dietary modification and exercise routine as treatment of ... ...cific and realistic goals that can be easily deliberate (e.g. walking/ running for 40 minutes, five times per week). contribute them rewards for achieving goals.9.Dont use food as reward.10.Limit sedentary behaviour nar rowing television/computer/video game time gradually from 3 hours/day to 2 hours/day, finally to 1 hours/day (most of the time the strategy of decrease childrens sedentary behaviour can be more effective than a strategy of promoting physical activity).11.Teach self monitoring to the childGive responsibility to monitor his/ her eating behaviour and physical activity by maintain logbooks/ diaries. Verbally praise the child for taking responsibility.12.Enhance open confabulation with the childLet the child be comfortable in sharing his/her feelings with you because many a times child would resort to food to overcome these prejudicious emotions/feelings.
Thursday, May 30, 2019
Neo Nazis :: essays research papers fc
Two Neo-Nazis have been convicted of murdering Black teen Benjamin Hermansen. A third defendant has been convicted of organism an accessory to the attack. The killing of 15-year-old Benjamin Hermansen spot he was meeting a friend near his space in Oslo sparked outrage. Tens of thousands of Norwegians took to the streets a few eld after the death to protest against racism and violence. Oslo City Court convicted Joe Erling Jahr, 20, and Ole Nicolai (Kvisler), 22, both linked to the bursting charge Boys neo-Nazi conference, of murder. Jahr was sentenced to 16 years in prison and (Nicolai) Kvisler 15 years. Veronica Andreassen, 18, was convicted as an accessory to the assault and jailed for three years. The salute give tongue to the murder was planned, racially motivated and committed by members of a Neo-Nazi group partly to spread fear. It also found that Jahr and (Nicolai) Kvisler had each stabbed Hermansen with different knives. "Benjamin Hermansen would not have been att acked if his unclothe had been the same colour as the defendants," the courts ruling said. The court said Jahr and (Nicolai) Kvisler had gone out that night with the intention of "getting a foreigner" and had brought knives. It said that while Andreassen did not participate in the attack, she went with them despite subtile they planned violence. Hermansen, who was active in his school and sports, was born and raised in Norway. He also had utter out against racism on national television receiver a few months before his death after he was assaulted by neo-Nazi youths during a soccer tournament in Denmark. (fare.net)That was a news article I found on a Norwegian anti-racist website. It happened only a few days ago on January 21st in Norway. This shows the prevalence of racism compose going on today. The group responsible for the murder belonged to an organization that calls themselves the Neo-Nazis.One of the questions Ive always asked in my history classes, is Why d o we need to bed about all this stuff that happened so long ago? Last year, my history teacher, Mr. Slater, gave me an answer. He said we need to learn about history, or we allow be doomed to repeat our past mistakes. With that said, Ill talk about how Nazism started.In the beginning, in that respect was Adolf Hitler. He lived a somewhat uninteresting intent as a child. His father was a customs official at the border separating Austria and Germany.Neo Nazis essays research papers fc Two Neo-Nazis have been convicted of murdering Black teenager Benjamin Hermansen. A third defendant has been convicted of being an accessory to the attack. The killing of 15-year-old Benjamin Hermansen while he was meeting a friend near his home in Oslo sparked outrage. Tens of thousands of Norwegians took to the streets a few days after the death to protest against racism and violence. Oslo City Court convicted Joe Erling Jahr, 20, and Ole Nicolai (Kvisler), 22, both linked to the Boot Boys neo- Nazi group, of murder. Jahr was sentenced to 16 years in prison and (Nicolai) Kvisler 15 years. Veronica Andreassen, 18, was convicted as an accessory to the assault and jailed for three years. The court said the murder was planned, racially motivated and committed by members of a Neo-Nazi group partly to spread fear. It also found that Jahr and (Nicolai) Kvisler had each stabbed Hermansen with different knives. "Benjamin Hermansen would not have been attacked if his skin had been the same colour as the defendants," the courts ruling said. The court said Jahr and (Nicolai) Kvisler had gone out that night with the intention of "getting a foreigner" and had brought knives. It said that while Andreassen did not participate in the attack, she went with them despite knowing they planned violence. Hermansen, who was active in his school and sports, was born and raised in Norway. He also had spoken out against racism on national television a few months before his death afte r he was assaulted by neo-Nazi youths during a soccer tournament in Denmark. (fare.net)That was a news article I found on a Norwegian anti-racist website. It happened only a few days ago on January 21st in Norway. This shows the prevalence of racism still going on today. The group responsible for the murder belonged to an organization that calls themselves the Neo-Nazis.One of the questions Ive always asked in my history classes, is Why do we need to know about all this stuff that happened so long ago? Last year, my history teacher, Mr. Slater, gave me an answer. He said we need to learn about history, or we will be doomed to repeat our past mistakes. With that said, Ill talk about how Nazism started.In the beginning, there was Adolf Hitler. He lived a somewhat uninteresting life as a child. His father was a customs official at the border separating Austria and Germany.
Wednesday, May 29, 2019
Automobile Air Pollution :: essays research papers
Automobile Air PollutionEfforts to improve the standard of quick for humans, through the control of character and the development of new products have also issueed in the pollution of the environment. Much of the worlds air, water, and land is straight partially poisoned by pollution. both(prenominal) places have become uninhabitable. This pollution exposes people all around the globe to new risks from disease. Many species of plants and animals have become endangered or are now extinct. The air pollution comes from lots of sources but the paper will be about air pollution cause by automobiles. As a result of tremendous amount of air pollution, primarily for automobile governments have passed laws to limit or reverse the threat of environmental pollution. There are lots of sources other than the automobile for air pollution. Nature itself is one of the causes. Sometime nature causes the air pollution by activities like a forest fire, volcanic, hurricane. These are temporary dis locations that nature balances and accommodates to modern economic development, however, sometimes disrupts natures delicate balance. The other source is from factories. Factories are release smokes and chemical in the air. In many places smoke from factories and cars combines with naturally occurring haze to form smog and create a midday sky. It had happened in London, London, England, has been subjected to the danger of smog, long recognized as a potential cause of death, especially for cured persons and those with severe respiratory ailments (pollution). Transportation by car though, is the major source of air pollution. Early in the century human invented, internal combustion locomotive, engine that use fuel as gasoline or diesel. Those engines were used to manufacture an automobile for fast travel from one place to another. Because they were not much in use, those few cars were not enough to threat the environment. Those engines were not fast enough so mastermind humans inve nted bigger and faster engines and those take more fuel. When these engines shine fuels they introduce smoke and other, less visible, by products. Once they are released into the air, the products of incomplete combustion, particulate matter (soot, ash, and other solids), unburned hydrocarbons, carbon monoxide, sulfur dioxide, various nitrogen oxides, ozone, and lead, bear with a series of chemical reactions in the presence of sunlight. The result is the dense haze characteristic of smog. Smog may appear brownish in ruse when it contains high concentrations of nitrogen dioxide, or it may look blue-gray when it contains large amounts of ozone (Danger).
Composting Essay -- Environment, Waste
Composting process as a means of bioremediating the harmful waste can be assessed in terms of its hygienic aspect since the effect of its quality is indicative of its essentiality and feasibility in the environment. Hygienic relevance of composting is primarily related to the microbes functioning as composters, the dust aerosols in the ambient air of the compost luck, and the type, concentration and state of the waste to be degraded. In terms of its hygienic feature, the compost may plant threat to human health as it generates immune response in living systems possibly triggered by leftover microbes, dust and target compounds to be tempered in the compost matter. Although many of the toxins and pathogens are diminished to a great number, the armorial bearing of pathogens in the compost might be able to contaminate the intellectual nourishment chain as plants get into contact with it. Composting is an acknowledged pathogen reducing technique, but certainly not an eradication syst em. Also the management of the process and heterogeneous pile conditions in compost may pose particular challenge concerning the biosafety of this process. Composting has been successfully adopted but enough biological research is lacking on the biosecurity of this process. because regarding the microbial profile of the compost, the experimental studies and characterization of microbes with respect to hygienic relevance by various scientists are discussed and reviewed as under.IntroductionComposting is the process of biodegrading the waste tangible in which an enormous number of materials like hydrocarbons, nitrogenous compounds, acids, their derivatives and even other organic and inorganic substances can be remediated from the environment (Finstein et al., 1986). Compost pro... ... Studies have shown that the presence of pathogens in a final compost may contaminate the food chain with the incomplete compost product provoking the growth of pathogenic microbes or keeping them ali ve and vigorous. Most notably, human pathogens like Aeromonas, Aspergillus fumigatus, A. terreus, Cryptosporidium and Giardia cysts, Enterococcus faecalis, Geotrichum candidum, GeoBacillus stearothermophilus, G. thermoglucosidasi, Klebsiella, Listeria monocytogenes, Pseudomonas, Saccharomonospora and Saccharopolyspora, Salmonella typhimurium, Shigella, Thermoactinomyces, Thermobifida, and Bacillus sp. being thermophilic and sporulating species still persist in a variety of compost. Studies are leaving on to give a better and ultimate solution view on the parameters for the eradication of various pathogenic strains activated or evolved during the process of composting.
Tuesday, May 28, 2019
The Coptic Museum in Cairo :: History, Informative
The Coptic Museum in Cairo is a life-like record of one of Egypts periods solely fraught with various antiques and monuments reflecting the different civilizations that graced the land of Egypt starting by the past Egyptian civilization, passing by the Greek, the papist, the Coptic, and lastly the Islamic. The Coptic Museum lies behind the walls of the famous Roman Fortress of Babylon in the ancient district of Cairo (Misr Al-Qadima). The ara contact the museum abounds in lively monuments of open museums that depict with the Coptic Museum the history of the Coptic menses in Egypt. Six paramount, ancient, Coptic Churches share ground with the Coptic Museum. They attend back somewhere between 5th and 8th century AD. The place holds the church of Abu Serga, the most ancient in Egypt. It was raised above the cave which the consecrate Family sought refuge into as they fled from Heroduss oppression to Egypt. The place, moreover, embraces Virgin Marys Church known as the Hanging C hurch a great ancient worship abode of world stature that was among the very first to host Coptic rituals on the subject of earth. The museum was built in an artchitectural style using wood in ceilings and oriels (arabesque and fretwork glass). Some biblical verses are written against them ornamented with Coptic embellishments like plants, especially grapevines, birds much(prenominal) as eagles, ostriches and peacock which all imply a certain school of thought and a specific significance in the Christian creed. Marble pillars and fountains ornamented with mosaic are more than present under the roof. The Coptic Museum in Cairo encloses noble-minded treasures from the Coptic Period exhibiting a dimension of Egypts civilization.The Coptic Museum in Cairo History, Informative The Coptic Museum in Cairo is a life-like record of one of Egypts periods all fraught with various antiques and monuments reflecting the different civilizations that graced the land of Egypt starting by the Ancient Egyptian civilization, passing by the Greek, the Roman, the Coptic, and lastly the Islamic. The Coptic Museum lies behind the walls of the famous Roman Fortress of Babylon in the ancient district of Cairo (Misr Al-Qadima). The area surrounding the museum abounds in lively monuments of open museums that depict with the Coptic Museum the history of the Coptic Period in Egypt. Six paramount, ancient, Coptic Churches share ground with the Coptic Museum. They date back somewhere between 5th and 8th century AD. The place holds the church of Abu Serga, the most ancient in Egypt. It was raised above the cave which the Holy Family sought refuge into as they fled from Heroduss oppression to Egypt. The place, moreover, embraces Virgin Marys Church known as the Hanging Church a great ancient worship house of world stature that was among the very first to host Coptic rituals on the face of earth. The museum was built in an artchitectural style using wood in ceilings and oriels (arabesque and lattice glass). Some biblical verses are written against them ornamented with Coptic embellishments like plants, especially grapevines, birds such as eagles, ostriches and peacock which all imply a certain philosophy and a specific significance in the Christian creed. Marble pillars and fountains ornamented with mosaic are more than present under the roof. The Coptic Museum in Cairo encloses rare treasures from the Coptic Period exhibiting a dimension of Egypts civilization.
The Coptic Museum in Cairo :: History, Informative
The Coptic Museum in capital of Egypt is a life-like record of one of Egypts periods every last(predicate) fraught with various antiques and monuments reflecting the varied civilizations that graced the land of Egypt starting by the Ancient Egyptian civilization, passing by the Greek, the Roman, the Coptic, and ultimately the Islamic. The Coptic Museum lies behind the walls of the famous Roman Fortress of Babylon in the antediluvian district of Cairo (Misr Al-Qadima). The area surrounding the museum abounds in lively monuments of open museums that trace with the Coptic Museum the history of the Coptic Period in Egypt. Six paramount, ancient, Coptic Churches share ground with the Coptic Museum. They date back somewhere between fifth and 8th century AD. The place holds the church of Abu Serga, the most ancient in Egypt. It was raised above the cave which the Holy Family sought refuge into as they fled from Heroduss conquest to Egypt. The place, moreover, embraces Virgin Marys Ch urch known as the Hanging Church a great ancient worship house of world stature that was among the very head start to host Coptic rituals on the face of earth. The museum was built in an artchitectural appearance using wood in ceilings and oriels (arabesque and lattice glass). Some biblical verses are compose against them ornamented with Coptic embellishments like plants, especially grapevines, birds such as eagles, ostriches and peacock which all imply a certain philosophy and a specific significance in the Christian creed. Marble pillars and fountains ornamented with mosaic are more than present downstairs the roof. The Coptic Museum in Cairo encloses rare treasures from the Coptic Period exhibiting a property of Egypts civilization.The Coptic Museum in Cairo History, Informative The Coptic Museum in Cairo is a life-like record of one of Egypts periods all fraught with various antiques and monuments reflecting the different civilizations that graced the land of Egypt starti ng by the Ancient Egyptian civilization, passing by the Greek, the Roman, the Coptic, and lastly the Islamic. The Coptic Museum lies behind the walls of the famous Roman Fortress of Babylon in the ancient district of Cairo (Misr Al-Qadima). The area surrounding the museum abounds in lively monuments of open museums that depict with the Coptic Museum the history of the Coptic Period in Egypt. Six paramount, ancient, Coptic Churches share ground with the Coptic Museum. They date back somewhere between 5th and 8th century AD. The place holds the church of Abu Serga, the most ancient in Egypt. It was raised above the cave which the Holy Family sought refuge into as they fled from Heroduss oppression to Egypt. The place, moreover, embraces Virgin Marys Church known as the Hanging Church a great ancient worship house of world stature that was among the very first to host Coptic rituals on the face of earth. The museum was built in an artchitectural style using wood in ceilings and oriels (arabesque and lattice glass). Some biblical verses are written against them ornamented with Coptic embellishments like plants, especially grapevines, birds such as eagles, ostriches and peacock which all imply a certain philosophy and a specific significance in the Christian creed. Marble pillars and fountains ornamented with mosaic are more than present under the roof. The Coptic Museum in Cairo encloses rare treasures from the Coptic Period exhibiting a dimension of Egypts civilization.
Monday, May 27, 2019
Modelling human decision-making
This report card anchors the development of the simulation modeling the human last making. Series of project excite been made and applied to attest the model mentioned. In specific, the focus of the project is about the process of using simulation and the orders which extracts knowledge about human decision making. One method used is the artificial intelligence method which figures out the decision-making strategies of human. And with this, it made possible to assess performance of the decision makers, who are the target respondents of the project. Moreover, the paper presents results of current projects done and motivational factors that affects the model, gentlemans gentleman decision making.1. IntroductionThere were previous studies and investigations made since mid-1990 on how to use and apply the artificial intelligence method as an alternative on the real subject, human decision making, in the simulation. This paper provides related literature that will be useful for prese nt and forthcoming projects about simulation of human decision-making.Starting from an idea generated when attempting to model rail marshalling yards, an artificial example of simulation and expert systems working in collaboration was generated. The ideas were so applied to a real case of maintenance operations at an engine assembly plant. Future work is looking into simulation as a means of knowledge elicitation. The paper briefly describes each of these phases of work and concludes by discussing why it is important to model human decision-makingConclusion Why Model Human Decision Making?Modeling human decision-making process for the improvement of human decision-making is far more important than the improvement of AI simulators. The development of the human genius is more important because in complex situations, the wit is more reliable and flexible in terms of making decisions. Simulators are mere copies of what the human mind can do, and thus, it is not that flexible in term s of changes.
Sunday, May 26, 2019
Gathering Blue Essay Essay
Kira is a female child with a twisted leg who lives in a more primitive society where people who cannot work, die. She has been kept alive by her mother, and when her mother dies, Kira is brought before the Council of Guardians. Kiras life is spared when she proves she can weave actually well, and she is assigned to the task of fixing up the robe worn by the singer whose only job is to sing the story of hu valet de chambre civilization erst a year. She meets Thomas, the boy whose duty is to carve the Singers staff. When finding out she needs to dye her own thread, Kira begins making a trip to the sea chantey of Annabella, an old woman who teaches Kira dyeing. Annabella shows her the plants needed to make every color, except for sour.Kira slowly learns that her life is less than idyllic. She hears crying in her building, and she and Thomas discover another strip lady friend whose ability is to sing and will eventually replace the current Singer. The orphan girl is scolded and pu nished if she does not sing Kira befri cans her but realizes she, Thomas, and the orphan girl do not have as much freedom as thought. At the Ceremony, she sees the Singer (whose robe she is fixing). She realizes that his feet are chained, and he is essentially a pris mavenr. The implication is that she and the others with gifts are also prisoners. Kira is also friends with a boy named Matt. He tells Kira of a settlement he once came across while lost in the woods. This village had blue. When the day that the Singer sings his song comes, Matt is nowhere to be found. He eventually returns with a blind man from the village in a blue shirt. The man, it turns out, is the father whom Kira thought was dead Christopher.He now lives in a community made up of wound and disabled people who help one another. Christopher has enemies on the council and is forced to return. Kira decides to stay in the village to continue to mend the singers robe and help improve the society she lives in. Eventu ally, close to the end of the book Matt tells Kira about a boy with blue eyes from the community her dad is from. He says he has blue eyes and is not injured in any way. He thinks Kira should get married with him, but Kira declines. That boy is later revealed to be Jonas from The Giver,a book also by Lowry.CharactersKira a vernal girl with a twisted leg and gifted in weaving She is the protagonist of the novelVandara an evil enemy of Kiras she requests that Kira be sent to the knit stitch to dieAnnabella an elderly woman who teaches Kira about dyesThomas Kiras friend, a young man gifted in wood carvingsJo a toddler girl gifted in singingMatt a young boy who helps Kira, Thomas, and (later) ChristopherJamison an older man, Kiras sponsor and mentor from the Council of Guardians later found to be the man who attempted to kill Christopher.Christopher Kiras fatherKatrina Kiras MotherBranch Matts dog
Saturday, May 25, 2019
Point of sale and inventory documentation Essay
Point of barter and Inventory corpse is a process wherein the business could monitor the movements of the products as well as the sales transactions. It is important for the company to take account farm animal of the products as well as the sales. Inventory refers total amount of goods and/or materials contained in a store at any or factory at any given age (Inventory, 2011) Even though technology is available, still many companies go for manual of arms dodging. Operating manual inventory is a time-consuming task, lots of paper works and slow date processing (Hamlet, 2011). It alike problematic in terms of communication streams. Each update or removal from the inventory must be updated daily (Cruz, 2010). Manual sales and inventory process was given up to errors that required time to rectify discrepancies (Inventory, nd.).Since manual inventory consumes a lot of time and is susceptible to errors, it would be helpful to build a establishment that will automate the transaction s from acquisition of the product description to updating the inventory database. Work efficiency of employees is defined as how productive they are in their work (Inventory, nd.). The causes of the discrepancies in the records are many, and some of the commonly observed unmatcheds are stock loss transaction error, inaccessible inventory, and incorrect product identification. variant loss, also known as shrinkage in industry, includes all forms of loss of the products available for sale. One common example is theft, which lowlife be committed by both shoppers (external theft) and employees (internal theft). With these problems of manual inventory formation, businesses emerged with computerized Point of sales and Inventory system of rules. It tracks purchases and sale transactions thought an organization.Point of Sale and Inventory System is a bastard used by retail businesses much(prenominal) as stores, supermarkets, and restaurants. It can register the purchase and keep tra ck of inventory. It also records information on the purchase including time and store location. It also manages the sales of retail goods. It makes a business much more efficient, lowering the costs of running the business while improving guest service and making the business more pleasant to work in (Smith &Harris, 2011) According to Hendeson (2011), that effective tracking of inventory is an imperative component to a sharp business successful operation. By having up-to-date data regarding all needed stocks for sale, the organization will drastically increase its bottom line. The amount of time that can be saved by the company is the biggest benefits of use a computerized point of sale and inventory system. Another benefit of a computerized point of sale and inventory system is the accuracy it ensures.The companies operation will be more effectively. The business owner or the passenger vehicle can ensure that the reports, purchased order and other documents associate to sales and inventory are uniform regardless of two created the reports (What are the benefits of Computerized gross sales and Inventory, n.d.). According to ruffling (2009), senior director of retail services for BBK Ltd., the trends in Sales and Inventory System are not just inventory accuracy but the use of pricing models to allow for markdown management. Based from the problems encountered in a manual point of sales and inventory system, developers draw up with this computerized point of sales and inventory system. Developers have chosen thirsty faulting successor Station and The sierra Spa started its operations in the year 2012 by Mr. Randy S. Quiniones. It is located at Sierra Heights Place, Sierra Madre St. Highway Hills, Mandaluyong City.The company is currently using a manual inventory system but aims for improvement to be competitive. In small businesses, inventory system is still applicable because of the advantages it provides the management. Inventory system makes the man agement of stock levels mush easier and more organized. It improves profits by accurately identifying the flow of stocks. The developers have come up with an idea developing a system that will improve the process and at the same time comes up with an idea developing a system that will improved the process and at the same time comes up with an efficient result of Inventory.The developers aim to eliminate possible problems due human errors that might occur during manual handling, like foolish tallying and recording of items and other products during the actual inventories. The proposed project entitled hungry(p) Teddy Refilling Station and The Sierra Spa Point of Sale and Inventory System deals with the tracking of regular costumers, supplies and deliverys inventory system. This system will be made actually for the management to reduce their work with concrete and invariable handling of data. Also itaims to build a consistent inventory system for the company that will surely help th e company for stability and profitability.Statement of the caperSales and Inventory has always been an issue in the part of manual procedures. Thus, the study seeks to answer the following 1. How to Design, develop and implement a Point of Sale and Inventory System? 2. How to develop a module that will be used for keeping and storing the entire items information? 3. How to develop a module for counting all the sales of the sold items? 4. How to develop a Computerized Point of Sales and Inventory System that will lessen time worn out(p) in processing of the payment? 5. How to generate reports faster on-time?Objectives of the studyThe developers aimed to designed, developed and test Point of Sale and Inventory System for thirsty(p) Teddy Refilling Station and The Sierra Spa, for them to become more competitive and to attract more customers specifically, it sought to answer the following objectives. 1. To identify the existing processes in terms ofa. Sales andb. Inventory2. To deter mine the software and hardware requirements of the system.3. To enumerate the features of the system and4. To test the acceptability of the system.Significance of the StudyThe system will bring innovations and modernization for thirsty Teddy Refilling Station and The Sierra Spa, and an effective way in providing a means of convenience and faster service. The following will be the beneficiaries Thirsty Teddy Refilling Station and The Sierra Spa. The system will give the company another asset to be used for them to attract customer by providing better services with regards to their improved point of sale system. Also it increases the companys competitiveness among other competitors. In this way, it may able to improve the Thirsty Teddy RefillingStation and The Sierra Spa image and professionalism through a better and well organized business. Manager. The system will help the jitney perform more efficient ways to operate the business. The manager will receive reliable and accurate re ports on inventory status and sales report. through these reports the manager can create a good business decisions, determine products that contribute to sales and create new business strategies and enhancement. Inventory Clerk. The clerk will be more productive in checking the stock-in and stock-out of the company. It will also help the inventory clerk in doing reports for the system will generate stock reports Cashier. Upon implementing the system, the rend will be more productive and efficient in doing work, providing reliable reports for manager and giving the customer quality service.The cashier will not use up about doing manual calculations, for the system will generate sales reports. Developers. In creating the system, developers will be able to apply knowledge acquired in school and come across new facts and ideas that will be a big help in the long run be in the world of business particularly in a system and software development. Other Developers. This will serve as th e great significance to other developers that will have similar studies. These developers may only improve and revise the outcome of this research.Scope and LimitationsThe study focused on the manager and cashiers requirements. The proposed system included only stocks monitoring process. The System is able to provide inventory reports and sales reports. There were two modules aim to developed- the administrator or manager module and the cashier module. In the Manager module, the manager can view, edit and delete user account as well as supplier accounts, view inventory as well as reports such as the stock in and stock out and the list of suppliers that can provide the stocks needed. The manager can also view stock that needs to be purchased as well as the status of each purchase order.In the Clerk module, the inventory clerk can add and edit information of stocks being delivered by the supplier. The said module enables the generation of information on the status of stocks, the bad orders, the stocks needed to be purchased and the suppliers that can provide the stocks. Inventory clerk is not allowed to delete suppliers information. In the Cashier model, sales transactionreceipt generation and purchase order is also included as one of the features of the system. The cashier can only view and add transactions, but is not allowed to delete and edit information made by the manager and the inventory clerk. earnest measures were also included. The user will simply login the user name and password to gain access in the system.Conceptual FrameworkThe developers aim to use Input-Process-Output (IPO) to sit paradigm of the study that illustrates the relationship between the input and output. The paradigm of the study exhibits the skeletal framework of the research study. The input consists of existing process of Thirsty Teddy Refilling Station and The Sierra Spa in terms of inventory and sales. Problems of the existing process are also needed in the development of the system. The developers also identify the features of the system and test the acceptability of the system. The phases of Waterfall Model will be the basis for the development of the system. This includes the following phases requirements, analysis, design and implementation. The output of this system is Thirsty Teddy Refilling Station and The Sierra Spa Point of Sale and Inventory System. Figure 1.1 in the succeeding page, shows the paradigm of the study to be conducted, to come up with the output of the propose system.
Friday, May 24, 2019
Araling Panlipunan Essay
The Human Poverty Index (HPI) was an indication of the standard of living in a country, developed by the United Nations (UN) to equilibrise the Human Development Index (HDI) and was first reported as part of the Human Development Report in 1997. It was considered to better reflect the extent of lack in developed countries compared to the HDI.1 In 2010 it was supplanted by the UNs Multidimensional Poverty Index. The HPI concentrates on the deprivation in the three essential elements of human life already reflected in the HDI longevity, knowledge and a decent standard of living. The HPI is derived separately for developing countries (HPI-1) and a group of select high-income OECD countries (HPI-2) to better reflect socio-economic differences and also the widely divergent measures of deprivation in the two groupsThe Gender Empowerment Measure (GEM) is the United Nations Development Programmes attempt to measure the extent of gender diversity across the globes countries, based on esti mates of womens relative economic income, participations in high-paying positions with economic power, and access to professional and parliamentary positions. In 1995 in the Human Development Report commissioned by the United Nations Development Program set-out to create two new measurement indices for measuring development. Their aim was to total to the Human Development Index by way of including a gender dimension in the measure.They were created in order to rival the traditional income-foc substance abused measures of development such as the Gross Domestic Product (GDP) and the Gross National Product (GNP). Haq, the first director of the Human Development Report Office, established several principles for the fresh emerging measure including provisions that it had to be simple, had to be represented as a single number, had to be easily calculated, had to yield numbers that were internationally comparable, had to use numbers available on a yearly basis and had to use numbers tha t were easily interpretable. The resulting measures that were created were the Gender-related Development Index (GDI) and the Gender Empowerment Measure (GEM). The GEM, the more than specialized of the two, is focused on indicating the relative empowerment of women in a given country.
Thursday, May 23, 2019
Sstill Seperate Still Unequal
In Kozols article Still Separate, Still Unequal-Americas educational apartheid, kozolool describes the reality of urban public schools and the isolation and segregation the students there depend today in the American system. Jonathan Kozol illustrates the grim reality of the inequality that African American and Hispanic children face within todays public education system. In this essay, Kozol shows us with shocking statistics and percentages, just how segregated Americas urban schools have become.He also brings light to the fact that suburban schools, with predominantly white students, are given far offend funding and a much higher quality education, than the poverty stricken schools of the ubarn neighbourhood He show us how we even built several bare-assed schools in mostly white neighbourhoods, hoping that the close proximity of the school would encourage white parents to send their children to those schools.Instead, when parents see that mostly African Americans and Hispanics a ttend these schools, they pull their children protrude of them and send them to private, white institutions. But never the less all this is not a proper justification of the gap that still exist between dour an white in the education system and in the active live. In this article the author point the fact that money is the key for a nice education, By trying to compare the curriculum of student from private with student from public school.The community school that my niece went was somewhere around 98% black and and Hispanic I would say they had a pretty good percentage in the of success for a school. Now she is attending college even that her parent is poor she show loan to go to school and she use her financial aid to be able to go to school as other. During the 100th anniversary celebration of the NAACP the president declares Weve got to say to our children, yes, if youre African American, the odds of growing up amid crime and gangs are higher.Yes, if you live in a poor neig hborhood, you will face challenges that somebody in a wealthy suburb does not have to face. But thats not a reason to get bad grades thats not a reason to faded class thats not a reason to give up on your education and drop out of school. No one has written your peck for you. Your destiny is in your hands you cannot forget that. Thats what we have to teach all of our children. No excuses. No excuses. You get that education all those hardships will just make you stronger, remedy able to compete. Yes we can.
Wednesday, May 22, 2019
Importance of Book of Romans to the History of the Church Essay
The Book of Romans is the one of the Letters in the New Testament of the Christian Bible.The Writing is simply reffered as the Romans and is currently one of the undisputed work of capital of Minnesota.The agree has been describe as a masterpiece which overwhelms the reader by the sublimity and the density of the topic which are discussed,the acknowledgment of the gospel and the revealing of the uprightness and the grace of God to all in all the mountain ,both Jews and the Gentiles.The view as is a letter which is written in a Greek initial century traditional letter writing style. During this cadence the writers started by identifying themselves and then names of the person they were sending the letter and then followed by the greetings. The letters ordinarily closed with the final greeting and seemlinesss. The book of Romans followed the akin style (Barth, K 1968)There existed a convention of believers in Rome who trusted in saviour as Messiah long before capital of Min nesota had planned to visit this town. There was a conflict between the Christian Jews and the new group up to the point that the Roman Emperor expelled them from Rome. More often there was a disagreement between the Jews and the gentiles concerning what nark one an acceptable person to God and the manner the followers of the Christ should conduct their lives.Having noniced the differences that characterized the church service in Rome capital of Minnesota decided to shed some light as far-off as the differences were concerned. There were masses who were going from door to door teaching doctrines which were confusing and mis leave behinding to the faithful. There are some who were saying that for one to be evaluate in the kingdom of God one has to refrain from eating particular kind of food and had to strictly follow the Law of Moses.These are issues that the book of Romans aimed at addressing so that this confusion that existed in the church can be cleared. Therefore to the church in Rome the book was essentially a tool of credit rating as far as what was expected of them was concerned. One of the reasons for Paul writing this book was to answer some of the question that emerged between the two groups. He boldly put it out in the book that the word of God was for all whether Gentiles or Jews. (Moo, D1996)The book of Roman is basically a treatise which is addressed to the church in Rome where Paul was introducing himself before he do his visit. Justification of the faith was the central theme for his letter. He was delivering the message that it is only done salvation that a man can have a good relationship with God. Anything else did non matter.What was expected from e really Christian whether Jews or Gentiles was the faith in God and through this salvation will be achieved. He explained that the Mosaic Law was non enough to make the Christian righteous. This works serves as an eye opener to the archean church as some of the issues that were co ntroversial at this quantify were distinctly explained by Paul. The differences that threatened to tear apart the church were tackled in this writing. To the Jewish Christians Paul explained that God had not completely broken his promise with them but he was working towards redemption of all the raft in the universe.For a long time Paul was planning to visit Rome but he was hindered from making such a move. Now he was determined to do it, he cherished to greet them and introduce himself before he made that journey. This visit was very important to him and the church in Rome as both were anxious. Paul was not sure how he was going to be received in this city and the some people there had criticized him before as they did not think he can be the leader of the church which was led by the Gentiles.The book of Romans serves as the assurance to the church in Rome that they are accepted in the kingdom of God like either other group despite them being Gentiles. Therefore Paul was mainl y writing this book to assure this group that they also had a right and a share in the kingdom of God. He assures them that Jesus died for all regardless of their status. The most important thing for any Christian was repentance and acceptance of Jesus Christ and leading a holy livenessspan. (Moo, D1996)Paul believed that the culture of Romans was very important as far as the church was concerned. It was the most powerful empire in the demesne and was located in the middle of the world at the time of Paul evangelism. This fact made the perform of Rome very important to the world at large. He understood the heavy(p) effect this church would have on the rest of the world especially the so called civilized world of that time. He clformer(a) saw the need of systematic and full presentation of the good news in this city.The people in Rome were looking forward to Paul visit in Rome as it would serve a great role as far as their church was concerned. This visit was taken as a formal r ecognition that a church that was led by the Gentiles. They had for a long time wondered how he can be an apostle of the church yet he fail to visit their church in Rome. This gave the church leaders an opportunity to gauge and infer his courage and honesty as far as the church was concerned.The book of Romans clearly explains the doctrines of the Christian faith. Paul in this book defended the gospel from those people who were claiming that salvation was for a chosen group. The church in Rome was to serve as a pillar where the Christianity would be spread to other regions in the world.The book clearly assures that the Roman church was as legitimate as the other despite the fact that it was led by gentiles. This served as a boost to this church as Paul was taken as the messenger of God and he was presenting the God word to the people who had chosen to follow Christ yet the society was not keen to respect them. Paul addresses them as his brethrens a clear indication that he had acce pted them as one of them and they were on the right track as far as faith was concerned. (Moo, D 2002)The book of Romans had a great impact on the early church and the western civilization at large.Scholars has argued that the book is the most influential in Christian archives. It is in this book that Paul gives a detailed exposition of the word of God. It is the most fundamental and systematic password as far as the whole plan of salvation is concerned.To the Romans the book touched on what they were supposed to do so that they can be saved. This applies to all the Christians and was largely quoted by the protestant reformers as they assured the faithful that the kingdom of god was reserved for all those who had faith in Him and they did not need the blessing of any man on earth for them to be allowed access into this Kingdom. The book was universal in application despite the fact that it was directed to the Church in Rome. (Moo, D1996)The book of Romans had greatly influenced ma ny people in the history of the church. The prominent theologians like Martin Luther had studied the book making them aware of what God expected from them. Martin Luther set in motion the teaching of salvation by the grace clear and he used it to spearhead the reforms in the church where he assured the faithful that it was through faith and grace alone that they were to be saved not from paying indulgences and other kind of in righteousices that existed in the church during the middle ages. (Dillenberger, J 1961)The protestant reformation was basically a recovery of the right and pure gospel which resulted in the increased gospel spread to the different parts of the world. It was a revival of the Apostles Paul work where he made a journey to various parts of the world taking the good news. Through studying the book of Romans Martin Luthers life was completely changed and so is the history of the church. The protestant reformation was as a result of this great theologian reading the book as the teaching was made available to the public. Lives were changed as the message of hope and righteousness was spread far and wide.The book clearly states that there is no Christianity without Jesus, he who comes to know him shall be saved. Martin preached the same(p) message that Paul wrote to the people of Rome and the early church.Martin Luther describe the book of Romans as the purest gospel which is worth and every Christian should understand it clearly. He advises the believers not to take the word practice of law in human terms as through doing this they will be confused as the people in the early church and they will be serving the church rather than living according to the will of God.He teaches them that God judges his people according to the heart. His law can not be satisfied by the works but rather on the inner most heart. He got these ideas from reading the work of Paul to the Romans. A book that he describes as full of inspiration to him and his search for t he truth .Paul says that all people are sinners in the eye of God and for us to be saved we have to seek the kingdom of God through following his teachings rather than following the law or the traditions as was the custom with the Christian Jews. If believers accustom themselves to the language described by Paul in the book of Romans Martin Luther says that they will find that there exists a difference between what the traditions of the church range and what God really expects. (Dillenberger, J 1961)Through the inspiration he received from the book of Romans Luther was able to challenge the church. The evils that characterized the church at this time has made him very disturbed and he set out on a mission to discover what can bring him close to God. The message he got was derived from the book of Romans where he realized that it was only through the grace of God that all will be brought close to God. The church was extremely corrupt where things that were going on were adverse to Gods expectation.Through the inspiration he was able to changeize the church and brought the light just as Paul shed the light to the people of Rome concerning what God expected from them. Martin Luther described Romans as the main book in the New Testament .His wish is for every Christian to use the book as a guide in our daily lives. As the systems are bound to confuse them as far as their faith is concerned just like it happened during his time when the Roman Catholic Church used the teachings to justify some of the evil things that were happening. The letter of Paul to the Romans would serve as the guide to the church and the believers if they are interested in the righteousness.Luther says that people should be ready to confess Jesus with their mouth and in such a deed they will lead a righteous life as they will alship canal aspire to do what God expects from them. Good deeds alone do not make a man righteous rather he should have faith in God. The book of Romans has been des cribed as the one that changed the course of the church history right from the early church to the protestant reformation. Therefore it is in order to say that this book contains message which are inspirational and can bring a complete change in ones life. It changed the life of the Augustine together with John Wesley people who had led a life that was not pleasant before the eyes of God.They had struggled with the evils ways up to a point when the word was revealed to them changing their lives completely. John Wesley had set out to preach without being converted, after some years of struggling and flunk he heard the teaching of Martin Luther describing the book of Romans. Listening to the true words of Luther the man was inspired and he was converted. He went to preach in many corners and has been described in the history of the church to have played a great role in the evangelical work of awakening the believers. (Moo, D 2002)The kind of life that God expects from every person is what has touched many people in the course of the church history. From martin Luther to John Wesley there was realization that God expects us to be righteous before his eyes as Paul maintained in the book. On the same line Gods wrath does not discriminate, it is express impartially to all the sinners neither does He discriminate between the Christian Jews and the gentiles.Before Paul sent the letter to the church in Rome the Jews prided to be the privileged people in the eyes of God but this notion was clearly explained by the book that set out to put the facts straight. On the same line the book of Romans came to be used in the protestant Reformation showing clearly that no one was too holy before the eyes of God to help in pardoning of the sins. Only God had the power to forgive the sins. The book as described by Luther addressed the issue clearly stating that no amount of payment towards indulgences was enough to forgive ones sins. (Moo, D1996)The book of Romans influence to th e church has been enormous right from the time Paul wrote the letter to clear the differences that existed in the Church of Rome. It is as a result of that explanation that the Gentiles faith was strengthened after understanding what God stood for as far as righteousness was concerned.The book deals with the issues of sin, modern sanctification, practical service and the gracious salvation issues that could have divided the church in Rome as Christian Jews and the Gentiles had different views regarding these issues. The book addresses God great plan for saving mankind by his grace. It clearly states that it is only through the grace of God that all those who believe in Him shall acquire this salvation. The book has been described as the comprehensive statement of faith and Christianity as a whole. It has been used by many believers to show what is expected of us and the church in general.The butt of the Christian faith is based on this book and this explains why the book has in ma ny cases changed the course of the church history especially when some people are out to mislead the believers in the matter of faith. Martin Luther used the book to show how the church had turned to be evil and led a revolution that came to bring openness in the church allowing people to read the word for themselves. (Hodge, C 1994)The book of Romans importance to the Christian faith can not be underestimated it has been relied on several occasions to shed light where misunderstandings have existed. The book has shaped the church making more responsive to the needs of a believer, move as much as possible to reconcile the two issues of law and righteousness. The strong foundation of the Christian faith is found in this letter of canonize Paul to the people of Rome.ReferenceDillenberger, J (1961) Martin Luther Selections from His Writings, New York, Doubleday and COMoo, D(1996)The Epistle to the Romans. Wm. B. Eerdmans Publishing CompanyMoo, D (2002) Encountering the Book of Romans A Theological Exposition, Michigan, Baker AcademicBarth, K (1968) The Epistle to the Romans. Oxford University Press, 1968.Hodge, C(1994) Commentary on Epistle to the Romans. Wm. B. Eerdmans Publishing Company
Tuesday, May 21, 2019
The Pros and Cons of Affirmative Action
The impression of affirmative action is found in a speech by prexy Kennedy when he was referring to the governments responsibility to ensure that affirmative action was taken with regard to equal employment opportunities for individuals regardless of race, creed, color, or national origin. It is interesting that although President Kennedy pioneered the concept of affirmative action, it was President Lyndon Johnson who first applied this concept by taking steps to equalize the presence of individuals in government positions.President Johnson draw that it was not enough to say that equal employment opportunities existed it was the governments responsibility to ensure that the positions not only existed, but were being filled by minorities in a commitment to pagan diversity. Directives were put into place as part of this process that not only banned discrimination, but also offered incentives to government contractors who employed a culturally-diverse workforce.Some of the pros of a ffirmative action, thitherfore, include increased opportunities for cultural minority groups, such as legislation that strongly urged employers to select minority candidates and contractors (given that they met qualifying criteria) Numerous inquiry studies have been conducted regarding the glass ceiling for women, as well as attempts to determine percentages of cultural identity in the white-collar professional positions (for example). Such studies have set that in that respect are more Caucasian males in positions of authority at a majority of companies.To rectify this, many agencies established affirmative action plans that were think to encourage minority applicants, and thus enlarge the pool of qualified applicants from which to draw for available positions. The downside to this, however, was that the legislation that was designed to encourage minority employment fostered the discrimination it seek to eradicate. To weight any individuals application due to demographic infor mation (as cultural information is) results in basic discrimination. One cannot have both options available both no-one is favored, or everyone is favored.To have two qualified individuals, and then to choose one based upon his or her cultural identity is at its heart discriminatory. At what elevation are professionals free to choose the best person for the job, without knowing the individuals cultural identity? In the ideal world, individuals would be interviewed by foretell or by e-mail in such a way as to reveal no identifying information. This would enable the employer to make a decision altogether upon an individuals qualifications and experience for the position, as opposed to fulfilling a criterion for minority employees.This is not, however, practical at this point in time, and so employment rests in the hands of companies who have an ethical obligation to be equitable, if for no other reason. Weighting a decision based upon cultural identity only applies if there is no opportunity for a variety of individuals to apply for a given position. The issue remains, however, that the individuals still need to be qualified for a position. Unfortunately, for whatever reason, there are differing degrees of qualification. No one appreciates being a token employee, yet that is the standard that affirmative action laws have succeeded in achieving.It is ironic that anti-discrimination laws are themselves discriminatory. The concept of fairness and equity for all individuals, then, should apply regardless of cultural identitynot because the company has no racial representation. Even the act of gathering cultural information is discriminatory because that information is being used to discriminate against other well-qualified individuals. All professionals who hire new employees must consider how they can action equity in employment without discrimination.
Monday, May 20, 2019
Mental Health and Social Inclusion
Title An examination of hearty exclusion polity and its effect on adults of a influenceing age with serious psychical wellness paradoxs To begin, this essay impart briefly particularise the term hearty exclusion and its historical postground. It entrust then move on to the political history of hearty exclusion in the United Kingdom. Particularly the essay willing centralize on the reasons behind un conflict, and the resulting effect of excluding peck from society.The policies around interlocking and the bring in system will be discussed in some detail, and their consequences on pretending age adults, including those with serious long term mental health issues. The French socialist political science termed the phrase social exclusion in the 1980s it was used to define a group of population living on the edge of society whom did not call for nark to the system of social insurance (Room, 1995 citied in Percy-Smith 2000). The concept of social exclusion has been defi ned in umteen different ways since then.The European commission defines social exclusion as referring to the multiple and changing factors resulting in people being excluded from the normal exchanges, practices and rights of modern society (Commission of the European Communities, 1993 quoted in Percy-Smith 2000 p. 3). This was a move outdoor(a) from using the term underclass in the UK, which was not an acceptable phrase to some, as it was more than(prenominal) link to p overty (Lavallette et al, 2001). The term social exclusion pointed at a much more complicated problem rather than incisively money, if you were excluded something or somebody was excluding you and that could be sorted out.Although for some this overbold phrase just represented a new form of the word poverty (Room, 1995 citied in Lavallette). In the UK the New dig up government set up the interdepartmental social exclusion unit in 1997 (Percy-Smith, 2000). Its depends were to to find joined-up solutions to th e joined-up problems of social exclusion (No10 Website, 2004). The social exclusion task force tames within a number of government departments such as work and pension, children school and family and the ministry of justice (No10 Website, 2004)The social exclusion unit published a series of reports in 1997 that criticised the way both central and local government had failed deprived groups and areas (Batty, 2002). It found that deprived areas had fewer basic services such as GP surgeries and that lower-ranking causal agent had been made to reintegrate some who had been excluded through unemployment (Batty, 2002). Unemployment is seen as one of the main causes of social exclusion (Percy-Smith, 2000). beingness unemployed can have serious effects on a persons confidence, thought of purpose and motivation (Percy-Smith, 2000).The person who works is seen as a full citizen, paying tax and lend to society (Baldock et al, 1999). Unemployment can also be linked to mental health a perso n is twice as give carely to suffer from depression if they are not working. ( department of health, 1999). The period since the 1960s saw a distinct decline in the British manufacturing industry leading to a shift in the figure of work available, the service celestial sphere and takeice establish jobs replaced the manual jobs and altered the pattern of demand in the labour market. Baldock et al, 1999) The unemployment rate for semi skilled / unskilled workers if four times that compared to managerial / professional workers (Percy-Smith, 2000). Those people who live in areas with downcast demand for low skilled workers are passing likely to be unemployed for a very long time, leading to a near permanency in exclusion from the labour market (Percy-Smith, 2000). Welfare to work policies were the answer from the Labour government in 1997, They set out plans to encourage people back into the labour market.Labour came up with the New Deal family of policies. These where aimed at specific groups. For example young people, adults and new deal for people with a check (Percy-Smith, 2000). One of the results of this policy was to create Job centre plus from a merger of the Employment Service and the Benefits Agency. (Hoben, no betrothal given) The Tories previously had set up the job seekers allowance, which had changed the Insurance-based unemployment benefit. (Baldock et al, 1999).With this allowance you had to prove you were actively seeking employment or you would not get your allowance. People who became unemployed would have to go for an initial call into question where an adviser prepares an proceeding plan, then short interviews are conducted every two workweeks to review the demandants success at gaining new employment and to look at new job vacancies (Percy-Smith, 2000). New deal gateway is aimed at 18 24 stratum olds who had been out of work for 6 months. This offers subsidised work experience within the unbidden sector or with an employer with a ? 0 a week incentive. overly full time education/ develop is offered to those who did not have comfortable qualifications up the recognized NVQ level two. Young people also have an allocated personal advisor who offers assistance around job seeking, careers advice and in some circumstances drugs/homelessness advice (Percy-Smith, 2000). Anyone who refuses to get up these incentives will have their benefit cut. As Gordon Brown put it (the then Chancellor of the Exchequer) there will be no option to stay at home in bed and watch boob tube (Baldock et al, 1999 p149).For people aged twenty five and above who have been on job seekers allowance for over six months then become bailable for a different set of measures, before becoming eligible for the New Deal. This is called restart. Work trials are offered as well as overhaul with interview techniques and CVs writing skills. After twelve months if the mortal has not found work they assure a five-day job plan workshop to asse ss the individuals job prospects. This happens again at eighteen months. If later two years they are still unemployed this is when New Deal applies. New Deal offers prep grants as well as an employment credit similar to that of the new deal gateway of 60 pounds a week and the benefit of a personal advisor. The budget for this was ? 250 million for the three years mingled with 1999 and 2002 (Percy-Smith, 2000) It can be argued that jobseekers allowance forces people back to work or forces them to appear to be tone for work in a desperate attempt to keep their benefit. It can be seen as correctional (Percy-Smith, 2000) and with no option to opt out, and it does not actually increase the amount of jobs available.Without the creation of a sufficient number of jobs, people whitethorn lose their benefit, though not through lack of trying (Baldock et al, 1999). Also critics have commented on the cost of the new deal strategy with some say this money could be better used creating more jobs. (Percy-Smith, 2000) Other arguments against new deal look at the timescale difference between the young people and adult services, it cost a lot less to intervene early when someone becomes unemployed so why wait for two years in the case of the adult new deal. (Percy-Smith, 2000).The new deal policy has been quite effective, particularly at getting young people back into the labour market. However, for people with long term significant mental health problems conclusion paid work can be very difficult. (Layard, 2005) If social exclusion can be linked to unemployment then for people with mental health issues they are excluded by default, with not only unemployment only when with the social stigma associated with their mental health difficulties (Layard, 2005). There are now more mentally ill people on fatuity benefit than there are unemployed people on jobseekers allowance (Layard, 2005 p1).Evidence suggests that work can be very therapeutic for people with mental health pr oblems, but it seems doctors are sceptical about their patients finding and holding down jobs. (Layard, 2005) The problem gets worse the longer the person is on benefits, and as time passes social isolation increases and motivation decreases (Layard, 2005). Ninety percent of people on incapacity benefit say they would like to return to work but would find it very hard to find a job that pays as much as the benefit they receive (Layard, 2005).However, it has been an underlying trend in offbeat policy that low paid work should always be the better option than state handouts. This goes way back to the paltry law of 1832 where the workhouse provided the last option for very poor families, providing food and shelter for the exchange of labour. For most of those who lived in these workhouses life expectancy significantly dropped upon entering these desperate places (Higginbotham, 2008). In current times, however, sacrificing benefits and returning to work may mean a compromise in qualit y of life.People receiving incapacity benefit may also claim housing benefit, council tax benefit, free prescriptions and discretionary loans from the social fund to buy large more overpriced items (Alcock, 2003). With all this help in place it is quite lite to see why people with a mental illness are unlikely to want to go back to full time employment and run the risk of losing money. This is known as the benefit trap. There is another problem, people who have been on benefits for a long time lack the right qualifications to join the labour market (Dummigan, 2007), increasing social exclusion.If a mentally ill person wanted to find a job but had little or no skills, the choices are very narrow normally leading to a low charter job, again fashioning it unlikely for the individual to want to come off his/her benefits (Dummigan, 2007). The government has tried to tame this problem by offering further incentives to get people back to work, such as disability tax credits that offer a tax break should some one find work but there is limited awareness of the financial incentives to return to work (Percy-Smith, 2000).Pathways to work is a juvenile government initiative with the aim of getting the recipients of incapacity benefit back to work, the claimant will have to take a personal capability assessment which is used to determine whether or not the person is eligable for the benefit, but will focus on what the customer can do rather than what they cant ( discussion section of work and pensions, 2007).A mandatary work focused interview will also take place eight weeks after making the intial claim followed by a screening tool to establish who will have to have more work focused interviews and those who will be exempt from further manditory participation (Department of work and pensions, 2007). Pathways to work will offer a range of programmes to support the customer in preparing for work with a fourty pounds a week incentive or credit for twelve months if thei r salary is below fifteen thousand pounds a year (Department of work and pensions, 2007).Pathways to work is currently operating in fourty percent of the country. In an interesting move, the remaining threescore percent of pathway to work providers will be from the public sector leading to critism that the government is privatising the welfare system. The governments chief welfare to work adviser, David Freud, said tardily I worked out that it is economically rational to exceed up to sixty thousand pounds on getting the average person on incapacity benefit into work, somebody will see a gap in the market and make their fortune. (Quoted in Vaux, 2008).Some voluntary sector organizations have criticized the rather aggressive approach taken by the public sector organizations in winning the contracts, and feel that the voluntary sector would be in a better position to tolerate the contracts (Vaux, 2008). Mind charity has criticized the pathways to work initiative stating it places all the emphasis on the individual to find work, yet, it saidtherewas no obligation on employers to actively recruit people with mental health problems. It would also seem that if you disclose to an employer that you have a mental health problem you are more likely to be sacked before your sane colleagues.Also there is a lack of support in the work place for mental health sufferers, which lead to higher sickness rate, which in turn puts off employers recruiting future pathways to work employees (Lombard, 2008). In the recent action plan on social exclusion stretch out the government recognizes the need for encouragement in the workplace for recruiting people with mental health issues and supports employer based anti-stigma campaigns. It also states that the government alone cannot address social exclusion, and that the wider community has a role to play.But most of all, the individual must want progress for themselves and those around them (Reaching Out, 2008). In the last five yea rs mental health services have improved greatly (Layard, 2005) Better treatment and early intervention have authorize people to control their own lives, but though these services have improved the medical condition, mentally ill people still suffer from exclusion from society. The association with dependency that being on benefits brings leads to a segregation (Percy-Smith, 2000). In conclusion, social exclusion is a far reaching problem and not an easy task to overcome.Evidence suggests that the government still identifies the problem with unemployment and poverty, and has taken a great deal of measures in providing policies that aim to get people back into the work place. Unfortunately for some, as has been shown, work is not always a viable or the best option, and people who fall under this category may stay on the boundaries of society due to no fault of their own, or be forced into working at the impairment of their health. The changes around the incapacity benefit rules may leave some people worse off than when on benefits and this may increase the chances of a relapse in mental ealth issues, which in turn will make them less employable, continuing the cycle of social exclusion. As we enter another recession and unemployment rises again, this is likely to be a huge focus, and the government will have to rethink existing policies around unemployment. Those who are recently unemployed must be given sufficient support to regain employment to avoid fall into the benefit trap in order to avoid the danger of becoming socially excluded. Bibliography Alcock, P (2003) brotherly policy in Britain, Basingstoke, PalgraveBaldock J, Manning N, Miller S & Vickerstaff S (1999) social Policy. Oxford University press, Oxford Lavalette,M & Pratt A (2001) Social Policy a conceptual and theoretical introduction. Sage publications London Percy-Smith, J (2000) Policy responses to social exclusion. Open university press. Oxford Batty, D (2002) Social exclusion the issue ex plained (Online), available at http//www. guardian. co. uk/society/2002/jan/15/socialexclusion1 (accessed on 28/10/08) Department for work and pensions, (2008) Pathways to work process. (Online) Available at http//www. dwp. gov. k/welfarereform/pathways_process. asp (accessed on 5/12/08) Department of health, (1999) National service framework for mental health, modern standards and service models. (Online) available at http//www. dh. gov. uk/en/Publicationsandstatistics/Publications/PublicationsPolicyAndGuidance/DH_4009598 (accessed on 1/12/08) Dummigan, G (2007) The benefit trap. (Online) available at http//news. bbc. co. uk/1/hi/programmes/politics_show/6403329. stm (accessed on 4/12/08) Higginbotham, P (2008) Poor laws (Online) available from http//www. workhouses. org. uk(accessed on 4/12/08)Hoban,M & Thomas, J (No find given) DW response to welfare to work discussion paper. (Online) available at http//www. voicefromthewheelchair. co. uk/pages/dw-response-to-welfare-to-work (a ccessed on 1/12/08) Layard, R (2005) Mental health Britains biggest social problem? (Online) Available from http//cep. lse. ac. uk/textonly/research/mentalhealth/RL414d. pdf (accessed on 1/12/08) Lombard, D (2008) The replacement of incapacity benefit. (Online), available at http//www. communitycare. co. uk/Articles/2008/10/27/109795/incapacity-benefit-reform-will-leave-some-disabled-people-worse-off. tml (accessed on 5/12/08) Reaching out, (2006) An action plan on social exclusion (Online), available from http//www. cabinetoffice. gov. uk/media/cabinetoffice/social_exclusion_task_force/assets/reaching_out/chapter1. pdf (accessed on 28/10/08) Social exclusion trends show success (2004) Online, available from http//www. number10. gov. uk/page5544 (accessed on 28/10/08) Vaux, G (2008). Pathways to work, to help those unfit for work. (Online), available at http//www. communitycare. co. uk/Articles/Article. aspx? liArticleID=107551&PrinterFriendly=true (accessed on 1/12/08)
Sunday, May 19, 2019
Discursive
Discursive EssaySean Killoran The death penalisation, used from 1707 and fully annuled in 1969, was said to befool cut crimes by two thirds. It is a controversial topic ever since it was created. It has taken the lives of guilty and destitute parties. In a recent survey 70% or the public want the death penalty reinstated for heavy crimes. Personally I feel the death penalty should only be used if a murderer has been proved guilty with flawless evidence. Many pile feel that the death penalty is a cruel and inhumane punishment for any pronounce.It brings forward the question that would we be any better than the someone standing in front of the jury ? There is also a major danger that an impartial person could be condemnd to death. There would be know way of releasing the person if there was able evidence from because they would be dead. For example, In 2004, the state of Texas executed Cameron Todd Willingham for starting the fire that killed his children. The Texas Forensic Science commitment found that the arson testimony that led to his conviction was based on flawed science.As of today, 138 wrongly convicted people on death row have been exonerated. One of the main reasons I feel people be against the death penalty is the cost. In Texas over 430 executions have been recorded since 1976, this has cost them $2. 3 million, which is almost deuce-ace times of which it would cost to imprison a convict. This makes people think why would you pay almost triple times the amount to kill a person just so the family can have penalize and justice. There is more than one side to this argument however.The death penalty did reduce crimes by two thirds therefore making the area a safer place. This gives the impression that a ruthless and no holds exclude attitude would be put towards the offender and possibly make early(a) people who are thought of committing think twice. Also there is no chance of re-offending as the type of people who are involuntary to do such a crime will effectively be wiped out. A judge could sen cristalce a man to bearing in prison. That same man could be out of jail with 15 years. How has life in jail become known as ten to fifteen ears? If the judge says life with no parole, then the criminal could stay in jail a bit longer, besides that would baseborn the country would have to take care of the prisoner for twenty to twenty five years. How can we reliance the murderers and thieves of our country to a law that will either let them out in ten years or have us take care of them for twenty years, and then let them go? The criminals do not fear the punishment anymore, because they know they will not die. Punishment is meant to be feared by the convict and to keep him from doing it again.I am not saying we execute all of the criminals in the world, nevertheless it has to remain an plectrum for the courts to use and to scare the criminals of the country. Many criminals dont fear the law. They know that they wi ll get out in ten years if they murder someone. They are not afraid of jail or their punishment. How can we force them to breaker point killing or stealing if they are not afraid of the punishment we give them. Most intellectual men are afraid of death. They dont want to die. There are also men that dont fear death, but enjoy killing.They must be controlled, but if they are sentenced to life, they are soon free to kill again. Again, I am not saying we should kill all the men in jail and any other criminal in the world. That is not the answer either, but we must have the death penalty as an option so that they will be afraid to break the law, and to control those who dont fear death but love to break the law. The Death Penalty has proven to have good benefits upon the country in find the consequences that criminals deserve. This is needed to ensure the safety of society.If this is the case, there is no need for us to consider the expenses involved in the death penalty. Certainly h uman lives are more important, for it may easily be yours. We should not abolish the death penalty, but hold our country accountable for properly using the death penalty upon those who deserve it. Sources YYwww. wikipedia. com-0 YYwww. answers. yahoo. com-1 YYwww. tnjn. com-2 Word Count 766 -0 http//www. wikipedia. com/ -1 http//www. answers. yahoo. com/ -2 http//www. tnjn. com/
Saturday, May 18, 2019
Aunt Jennifers Tiger Essay
aunt Jennifers tigers is a poem by Adrienne Rich illustrating her feminist concerns. In the male dominant world, a women of her time was only supposed to be a dutiful homemaker. This poem through the world of aunty Jennifer, assures us just about her inner liking to release herself from the clutches of abusive marriage and patriarchal society. Poem Summary The first stanza opens with Aunt Jennifers visual tapestry of tigers who are fearless of their environment. Bright topaz1 denizens2 of a world of green evoke an calculate that these regal tigers are unafraid of other beingnesss in the jungle.Bright here signifies their powerful and radiant persona. in that respect is a sense of certainty and confidence in the way these tigers move as can be seen in the line They pace in sleek chivalric3 certainty. In the second stanza, the reality of Aunt Jennifer is revealed as she is feeble, weak and enslaved, very much the opposite of the tigers she was knitting. Her physical and mental trauma is depicted in the line find even the ivory needle hard to pull.Even though a wedding ring doesnt weigh much, the massive weight of uncles wedding band, sits heavily upon Aunt Jennifers hand signifies the amount of dominance her husband exercised over her. This also means that her inner free spirit has been jailed by the patriarchal society4. The last stanza starts on a creepy note about Aunt Jennifers death. Even her death couldnt free her from the ordeals she went through which can be seen in When Aunt is dead, her terrified hands will lie still ringed with ordeals she was mastered by. objet dart driving from her parents home to Cochin, she notices her mother sitting beside her dozing, her face pale like a dead body and her thoughts far away. This reminds her painfully that her mother is old and could pass away leaving her alone. place that thought aside she looked out at the young trees speeding by and children running out of their homes merrily to play. These remind he r probably of youth and life, her own younger days and her mother when she was young.But after the guarantor check at the airport, looking at back at her mother standing a few yards away, she finds her looking pale like the winter moon. She feels that familiar pain and childhood fear of the thought of losing her mother and of being lonely just as she had been when she was young because she was different from other children. She could only keep smiling and tell her see you soon knowing full well that she might not see her.
Friday, May 17, 2019
Limited Power of the People
Mans destiny is at his own hands. Certainly squ ar(a) nowadays for most heap, scarce there was a time when, and presently in some areas where, people do not decide their own destiny. Destiny of those people was decided upon by their masters or their formulas.In the early modern period (1500s 1700s) most people do not have the opulence to direct their own path. Take for example the Africans and the people under some monarch. During this time, Africans were compelled to be slaves and imported to europium and America. While in the case of people under monarchy, their laws are under the authority of their ruler.According to the genuine Law of Free Monarchies written by crowd together I of Eng bring, the king is responsible for the whole land and his subjects. He is the master of every individual residing in his kingdom. He had the government agency over the life and shoemakers last of his people. In a monarch, rules and laws made by the king were crafted at his followers advi se or proposal but it is still subjected to the kings discretion on what to implement when times arises. His authority solely made these laws official. Implementation or revoking of certain laws or policies is within his bounds alone.The people are put to oath to be loyal followers of their king and his predecessors. Generally, a kings subject has a sort of liberty as long as they follow the rules of the land and whatever the king wishes them to do. Most of the kings give very harsh punishment to those persons who do not follow his orders. The king is not bound to anything except his conscience and his goodwill to his subjects.As for the slaves, they do not have the conveniences savored by the followers of the king. They absolutely do not have the emancipation to do their own will. Slaves were commonly captives or prisoners of war. The victors, rather than killing them, prefer to make use of them or profit from them. Later on, slavery was brought about by racial discrimination. Sl avery trade soon flourished when refinement progressed. They use/bought these slaves for the manpower needed to produce the needs of their people, especially for doing arduous tasks. They were usually traded in diversify for money, pabulums, goods or ammunitions. The slaves were usually kept inside the cages or tied around a tree.According to Bosman, the slaves were maiden examined by a physician before they purchase them. All those handicapped were set aside, only the physically fit ones were bought. They were also branded for easy identification of their buyers. With regards to food during the voyage, the slaves were fed thrice a day, the food much better than the food that they were eating at their place according to Bosman. Their sleeping area is split per gender.One part is designated for men, the other is for women. They usually lie very close to each other because they are usually crowded due to the large number of slaves shipped. Majority of the slaves were treated poor ly and cruelly by their masters. Very seldom will you find masters that are good to their slaves. Some who are foursquare were beaten to death. Slaves were not allowed to marry their masters or mistresses but there are some hugger-mugger relationships that transpired.The world of these people was very limited especially the slaves. They do everything that was asked by their master or ruler and they do not have the right to complain. Some even kill themselves when told to do so by their masters. Their lives were literally on their masters hands. Over time, slavery trade dwindled down because of some resistance and laws enacted upon by sympathetic individuals, monarchy had also been lax with their subject. But if you look around, the idea of slavery or ruling over somebody has not been totally obliterated, some people still do not have the power to choose their own destiny.In the present years, slavery is not so obvious. Though it still exists but it operates discreetly. It is demo by ruling class or rich people by using their money power to influence and dictate the lives of the poor. They have all the power to manipulate them, a discreet demonstration of slavery. kit and boodle Cited PageBosman, Willem. A. A New and Accurate Description of the Coast of Guinea Divided into the Gold, the Slave, and the Ivory Coasts. http//www.cambridge.org/resources/0521808944/3355_WiesnerHanks%20ch13%20sources.pdf James I. True Law of Free Monarchies. http//www.thenagain.info/Classes/Sources/JamesI.htmlLain, Zachary. All Men Are Created Equal Or Are They? The triangular Slave Trade. http//dhr.dos.state.fl.us/museum/programs/historyfair/Lain.pdf
Thursday, May 16, 2019
Baroque and Rococo Art Periods Essay
The Baroque machination era is classified by many as Early Baroque, High Baroque, and Late Baroque closes. The fancy Art era is often said to be p cunning of the Late Baroque period. The time position of the rococo era and whether it is bingle and the same as the Late Baroque period have been in debate through with(predicate) the years. Although the Baroque Art and the Rococo Art periods are sometimes classified as one in the same, they are actually quite distinct and unique. The Baroque Art period was surrounded by 1600 and the mid 1700s, and originated during the Catholic Reformation in Rome, Italy, and quickly spread throughout most of Europe. During the late 1500s, the Protestant reformation started to attack the Catholic Church on doctrine. In response to these attacks, the Catholic Pope started a movement within the church to reaffirm and spread Catholic beliefs. During this time, most sight were uneducated and untaught so the church had to devise a way to spread the gospel message so everyone would understand. It was dogged that the message would be spread through art. This art was to be direct, emotionally persuasive, and powerful-designed to fire the spiritual sight and inspire the viewer to greater piety.The church felt that God of greatness and power should be worshiped with the kinds of rituals, ceremonies, and churches proper these divine qualities. (McKay & McKay, 2010) So began the Baroque movement with its dramatic exercise of color in paintings and computer architecture that was forceful, emotional, and extravagant. The Rococo art period emerged in the mid-17th century as a continuation of the Baroque art period. By the end of his seventy two-year manage Louis XIV led his country victoriously through numerous wars and France had long replaced Spain as the continental power. He is known in history as one of greatest French kings but also as a micromanaging control freak. (Zaky. n.d.) The Baroque style during his reign represented the Catholic faith and the monarchy with art that was direct, obvious, and dramatic. (McKay & McKay, 2010) Louis XIV was succeeded by Louis XV who reigned during the height of the Age of foresight era, a time where attitudes and morals loosened. The enlightenment movement was in opposition to the established church, as it promoted thought process for oneself and not following a deity. The art of this time period centered around a devil-may-care lifestyle rather than the symbols and rules of the church. It had no place for morality, saints or heroes, painting were neither didactic nor devotional. (Zaky. n.d.) Theart was meant to ravish the eye of the viewer with no real meaning behind it.The art also portrayed the occasional life, not just important moments in history. The Baroque art movement was stern and originated from the Catholic church wanting to spread religion. The Rococo art movement came about from the Enlightenment era where people cute to think for themselves inste ad of being told what to think by the church or monarchy. The Baroque style depict heroism, martyrs, and biblical stories, but Rococo painters showed themes of love, youth, and playfulness. (Zaky. n.d.) The Baroque artists used dark, stormy colors, whereas Rococo used light, soft bright colors. Baroque art was made to be unwrapn and used as propaganda for the Catholic church, and the artwork and architecture was vainglorious and bold. The Rococo art was smaller in scale to be enjoyed by a person or family as a decoration. The change from the Baroque period to the Rococo period was significant in that it shows the passageway of the society at that time. The Monarchy and Catholic Church were both under scrutiny for excessive spending and what people viewed as political tyranny. The change in attitude by the people not only bear on the political environment but also the arts.Tired of oppression, they revolted politically by beheading King Louis XV and by changing the way they cre ated and viewed art. The painting, Descent from the Cross, by Rembrandt is a classic example of the Baroque style. His use of dark colors and shadowing depicts the death of Christ and creates a dramatic eyeshot. He uses light to hear Christs body, Mary, and the cloth that he will be buried in. The painting depicts the religious scene so that the viewer can understand the significance of the event and contemplate its meaning. In contrast The Swing, by Jean-Honore Fragonard, is of a woman swinging carefree in a garden. Fragonard uses pastel colors and illuminates her from the surrounding trees. He places cherubs in the painting another characteristic of the Rococo style. This painting is interesting in that at commencement exercise glance it seems that this is nothing more than an innocent day in the garden. Upon further inspection, one can see the way Fragonard was bold enough to mock the Baroque style and time period. The man sits at a place where he is able to see up the womans skirt as she swings supra him symbolizing the free spirit and sexuality of the time. The servant is almost completely hidden, symbolizing the church no longer being as important in society.One areaof art from the Rococo period that is often overlooked is the furniture form of architecture. During this time period a shift was made from handsome and grand rooms to small, intimate, and personal spaces. The furniture was redesigned to reflect this change and the desire for comfort. The Bergre tame was designed with cushioning in the seat and arms which made it comfortable and kept out drafts. (Azzarito. n.d.) The painting, A Reading of Moliere by Jean Franois De Troy, depicts this idea of comfort showing women lounging in the Bergere chairs. (Troy. 1728) The Bergre was a favorite chair of the most fashionable women of the day and is still one that is used in homes at present making it a surprising example of a work of Rococo art that has survived through the years. (Azzarito, n.d.) T he artists of the Rococo period experimented with color, light, and illusion, and mastered the technique of layering paints to make a object look opalescent in color. They created the champion of texture in their paintings, which was not done during the Baroque period. The artists of the Rococo art period mastered tonic techniques, giving important significance to the time period. Although the Baroque Art and the Rococo Art periods are sometimes classified as one in the same, they are distinct and unique.
Wednesday, May 15, 2019
Gender inequalities in the Middle East Essay Example | Topics and Well Written Essays - 1500 words
Gender inequalities in the Middle East - Essay ExampleOn addressing the impact of leanness and microfinance on gender/ bureau dealings and womens empowerment,this study engraves itself into broader discourses and debates on gendered inequalities in the Middle East.Introducing the stage setting that Saudi-Arabian Arabia is an undisguised,self-evident patriarchal state,this study aims at investigating the positive and negative implications on female clients. By studying the microfinance initiatives and examining the underlying principles of Bab Rizq Jameel (BRJ), the positive and negative implication on female clients are analyzed, particularly in terms of its effects on their decision-making and bargaining power in the household. This case study on microfinance in the kingdom of Saudi Arabia aspires to unfold an important and lacking dimension to the current debates surrounding gender and outgrowth in developing countries. Keywords Microfinance, Saudi Arabia, Bab Rizq Jameel (BRJ ), gender relations, womens economic/social empowerment, bargaining power, decision-making and household. Introduction Microfinance institutions interchange in terms of their goals, agendas and assumptions. at that place have been continual debates on whether microfinance can be considered as a savior to poverty-stricken women from oppression and gendered inequalities or whether having access to micro-financial resources can empower women economically. There are studies which argue that microcredit helps to empower women thus promoting gender-equality and improving household well-being while microfinance does not instantly challenge any official views that subjugate women (Aminul et al., 2011). Women are treated as second-class citizens and are mainly oppressed by the justnesss and constraints imposed on them through patriarchal states such as Shareea law in the kingdom of Saudi Arabia. There are also the traditions and customs that give rise to inequalities and gendered theat rical role of roles that are produced and reinforced from relationships that are intrinsically gendered within the household (Khateeb, 2011). This study being the vanguard of question on gender and development through microfinance, it felt natural that the appropriate start should be from the stinkpot roots level, the household. Gender-related rigidity in the intra-household is the core institution where the microfinance women clients spend most of their time. This study primarily deals with investigating the impact of microfinance on gender relations in the household. Professor M. Khateeb (Khateeb, 2011) in her lecture roughly gender, household and domestic domain points out that there is an explicit focus on the household because it is the order of the earliest socialisation processes and gender identity formation. Secondly, it is central to the analysis of the organisation of production and reproduction in different societies. The gender division of roles, responsibilities an d resources within the household play an important role in formation what men and women are able to do beyond the household. And finally a great deal of policy, twain economic and social, is premised on assumptions about how gender relations are organised within households. This study last aims at assisting and enabling the policy makers of BRJ Microfinance programme to create policies that prioritise the impact of microfinance on gender relations in intra-household. On having a wider examination of BRJs assumptions, rationale and process coupled with gender power relations within household, policy makers would be able to arrive at a more close representation of the graving issue of unemployment and would also travel at a more effective outcome. Aims 1. How does microfinance impact gender relations in Saudi Arabia? 2. Effects of micro-financial resources in Saudi Arabia on women empowerment both in household and in society?1 3. How do micro-financial resources effect on the well -being of the families in Saudi Arabia in terms of survival, security, financial self-reliance and autonomy on various levels (Kabeer, 1994304)? Objectives This
Tuesday, May 14, 2019
Gene Analysis Essay Example | Topics and Well Written Essays - 1000 words
Gene Analysis - Essay ExampleGene therapy, combine vectors carrying therapeutic trans component sequences offers the potential for a permanent cure of componenttic diseases by stable vector origination into the patients chromosomes (1). However there are some reports indicating occurrence of tumors at later stage in transgenic living creature and thats why it is important to know probability of non specific integration of this transgene and its effect on mobile phoneular homeostasis. As per the present understanding the integration is semi-random in nature and having partial preference towards sequences in or skillful the coding regions of expressed genes (1). Integration in these places may lead to up or down command of that particular gene and hence increase the probability of interference in cellular homeostasis. Based on above observations, it is highly recommended to verify the insertion loci of given vectors in model system. Based on bio-informatical analytic thinking o f given sequence, we were able to demonstrated that Viral vector integrates in vicinity to gene called Nfib (Nuclear factor I/B) and interferes with it normal functioning. Detailed investigation and database search indicates Nfib has potential role in cell cycle canon and oncogenesis.Vectors, transfection, cloning, amplification and sequencing were performed as per previously mention protocol (1). For identification of gene and its functionality sequence was husk against the walk genome database (http//www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgitaxid=10090). Similarly for further verification, sequence was BLAT (http//genome.brc.mcw.edu/cgi-bin/hgBlat) and also compared in RTCGD (http//rtcgd.abcc.ncifcrf.gov/). , to investigate presence of similar gene entry in the data base.GeneSequence 5AAAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAATAATAAA AGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 3Results and discussion The sequence was used for similarity search by BLAST i n mouse genome database. All the default parameters were kept without changing for identification of match. Fig 1 shows results obtained later BLAST of given sequence.FIG 1 BLAST resultsrefNT_039260.7Mm4_39300_37 Mus musculus chromosome 4 genomic contig, strain C57BL/6Jduration=28591323 Features in this part of subject sequence nuclear factor I/B Score = 191 bits (103), wear = 1e-46 Identities = 103/103 (100%), Gaps = 0/103 (0%) Strand=Plus/PlusQuery 2 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 61 Sbjct 21590158 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 21590217Query 62 AATAAAAGACAGCCAGTTGAAGGAAGAtttttttttttCAATT 104Sbjct 21590218 AATAAAAGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 21590260 As seen above, 100% matching were obtained with very low E values (1e-46) which clearly indicates the given sequence belongs to gene called nfib (Nuclear factor I/B). It is located on chromosome 4 (Chr481761404-82176981 bp, - strand). Nfib is member of protein famil y having diverged role in transcription and cell cycle regulation.Similarly BLAT analysis retrieves same gene against the query of given sequence.
Subscribe to:
Comments (Atom)